Test tasks for the topic molecular level. Biology test on the topic "Molecular level" (grade 9). Topic: “Molecular standard of living”

Option 1

Part A 1. The monomer of a protein molecule is 1) a nitrogenous base 2) a monosaccharide 3) an amino acid 4) a lipid

2. Most enzymes are 1) carbohydrates 2) lipids 3) amino acids 4) proteins

3. The building function of carbohydrates is that they

1) form a cellulose cell wall in plants 2) are biopolymers

3) are able to dissolve in water 4) serve as a reserve substance of an animal cell

4. Lipids play an important role in the life of a cell, since they

1) are enzymes 2) dissolve in water 3) serve as a source of energy 4) maintain a constant environment in the cell.

5. Proteins, unlike carbohydrates, have the ability to

1) solubility 2) denaturation 3) conduction of nerve impulses 4) accumulation of large amounts of energy

6. Which pairs of nucleotides form hydrogen bonds in a DNA molecule (complementary)?

1) adenine and thymine 2) adenine and cytosine 3) guanine and thymine 4) uracil and thymine

Part B 1 . The RNA molecule contains:

A) ribose B) guanium C) magnesium cation D) deoxyribose E) amino acid E) phosphoric acid

2. Establish a correspondence between the function of the compound and the biopolymer for which it is characteristic. In the table below, under each number that defines the position of the first column, write down the letter corresponding to the position of the second column

FUNCTION BIOPOLYMER

1) storage of hereditary information A) protein B) DNA

2) formation of new molecules by self-duplication

3) acceleration of chemical reactions

4) is an essential component of the cell membrane

5) neutralization of antigens

1

2

3

4

5

Part WITH

Why doesn't glucose play a storage role in the cell?

Test on the topic " Molecular level organizations." Option 2

Part A 1. The bond between monomers in a protein molecule is called

1) hydrogen 2) ionic 3) peptide 4) energy-intensive

2. The protective function of proteins is manifested in the fact that they

1) undergo denaturation 2) serve as antibodies 3) participate in the construction of cells 4) transport gases

3. What reserve nutrient serves as the energy reserve of the cell?

1) starch 2) amino acid 3) nucleic acid 4) polysaccharide - chitin

4. Fats in the cell provide

1) transport of hydrophilic (water-soluble) substances 2) dissolution of hydrophobic (water-insoluble) substances 3) acceleration of chemical reactions 4) motor function

5. The main function of carbohydrates compared to proteins is

1) construction 2) protective 3) catalytic 4) energy

6.What carbohydrate is included in RNA nucleotides? 1) ribose 2) glucose 3) sucrose 4) deoxyribose

Part B

1. The DNA molecule contains

A) phosphoric acid B) adenine C) ribose D) deoxyribose E) uracil E) iron cation

Write the answer as a sequence of letters in alphabetical order (without spaces or other symbols).

2. Establish a correspondence between the function of the compound and the biopolymer for which it is characteristic. In the table below, under each number that defines the position of the first column, write down the letter corresponding to the position of the second column.

FUNCTION BIOPOLYMER

1) formation of cell walls A) polysaccharide B) nucleic acid

2) transport of amino acids

3) storage of hereditary information

4) serves as a reserve nutrient

5) provides the cell with energy

Write down the resulting sequence of letters in the table and transfer it to the answer form (without spaces or other symbols).

1

2

3

4

5

Part C.1. Why is starch classified as a biopolymer and what property of starch determines its storage function in the cell?

Test on topics: “Molecular and cellular levels” (biology 9th grade)

Choose one correct answer out of four.

A 1 . After the advent of the electron microscope, scientists discovered in the cell:

1. core 3) vacuole
2. ribosomes 4) chloroplasts

A 2. In the table below, between the positions of the first and second column

there is a relationship.

Object Process

ribosome protein synthesis in body cells

cell membrane…

In the blank space in this table you should enter:

1) fat synthesis

2) transport of substances

3) ATP synthesis

4) cell division

A 3. The hereditary apparatus of the cell is located in

1) core
2) ribosome
3) vacuoles
4) Golgi apparatus A 4. The main result of photosynthesisis education: water and energy carbon dioxide and oxygen organic matter and oxygen nitrogen and oxygen A 5. You can tell a plant cell from an animal cell by: presence of cell membrane lack of core presence of chloroplasts presence of mitochondria A 6. Cellular structures formed by DNA and protein are called: Golgi apparatus chloroplasts mitochondria chromosomes A 7. Protein is synthesized in the cell: on ribosomes in the core in lysosomes on smooth EPS

A 8. Digestion of food particles and removal of dead cells occurs in the body with the help of:

1. Golgi apparatus
2. endoplasmic reticulum
3. lysosomes
4. ribosomes

A 9. What is the function of the cell center?

1. participates in cell division
2. participates in protein synthesis
3. participates in the transport of organic substances
4. participates in the breakdown of substances

A 10. What is the haploid set of chromosomes in cancer cells if diploid is equal to 118:

1. 236 2) 59 3) 100 4) 80

A 11. The set of chromosomes of an organism is called:

1. Caries 2) karyoplasm 3) karyotype 4) genotype

A 12. The inner membrane of mitochondria forms:

1. Grana 2) chromatin 3) cristae 4) stroma

A 13. Organelle that can reproduce independently:

1. EPS 2) mitochondria 3) nucleus 4) ribosome

A 14. Organic substances during photosynthesis are formed from:

1. Proteins and carbohydrates
2. Oxygen and carbon dioxide
3. Carbon dioxide and water
4. Oxygen and hydrogen

A 15. Membrane channels are formed by molecules:

1. Proteins 2) carbohydrates 3) lipids 4) nucleic acids

IN 1. Establish a correspondence between the structure of a cell and its appearance. To do this, select a position from the second column for each element of the first column. Enter the numbers of the selected answers in the table.

Answer:

AT 2. Insert the missing terms from the list provided into the text.

Cellular organelles perform various functions that ensure the life of the cell. For example, in chloroplasts plant cells _______________ occurs, and ____________ is synthesized on ribosomes. Mitochondria produce and accumulate ____________, and the nucleus stores __________.

1. transport of substances 4-hereditary information
2. photosynthesis 5-ATP
3. starch 6-protein

AT 3. Choose three correct answers out of six.

Select the processes that result in energy being stored in the cell:

1. protein biosynthesis
2. DNA doubling
3. photosynthesis
4. nutrient oxidation
5. oxygen-free breathing
6. cell division

From 1. Read the text and fill out the table according to its sections.

Protein biosynthesis

Protein biosynthesis is a process during which hereditary information encoded in genes is realized in the form of a specific sequence of amino acids in protein molecules. It all starts with the synthesis of messenger RNA on a certain section of DNA. Messenger RNA exits through the pores of the nuclear membrane into the cytoplasm and attaches to the ribosome. The cytoplasm contains transfer RNAs and amino acids. Transfer RNAs recognize a triplet of nucleotides on the messenger RNA at one end, and attach certain amino acids to the other. Having attached an amino acid, transfer RNA goes to the ribosomes, where, having found the required triple of nucleotides encoding this amino acid, it is cleaved into the synthesized protein chain. Each stage of biosynthesis is catalyzed by a specific enzyme and provided with ATP energy.

Answers:

Part A.

A10

A11

A12

"Molecular level"

9th grade

1 option

1. DNA monomer
2. Where is the hereditary material of viruses located?A) in the cytoplasm; B) in the nucleus;B) in a special shell.
3. DNA does not contain nucleotides:
a) ribose b) thymine c) uracil

4. Primary protein structure
5. Functions of mRNAA) stores genetic information; B) collects protein molecules;C) transfers genetic information from the nucleus to the site of protein synthesis;D) delivers amino acids to the ribosome.
6. Protein monomerA) amino acid; B) nucleotide;B) monosaccharides; D) glycerol and fatty acids.
7. A-T compliance, G-C, A-U is called:
a) transcription b) reduplicationee c) complementarity. The DNA strands are held together by:
a) peptide bonds b) ionic bonds c) hydrogen bonds
9. Protein secondary structureA) chain of amino acids; B) globule;B) spiral; D) several globules collected into a single complex.
10. Functions of DNAA) stores genetic information; B) delivers amino acids to the ribosome;D) collects protein molecules; D) participates in protein biosynthesis.
11. RNAs are found in:
a) nucleus b) cytoplasm c) ribosomes

12. The process of loss of natural protein structure:
a) renaturation b) denaturation
c) homeostasis

13. Biological catalysts are:
a) antigens b) antibodies c) enzymes

14. Enzyme:
a) accelerates several types of reactions at once
b) operates within narrow temperature limits
c) can only work at a certain pH value of the environment

15. Functions of carbohydrates in animal cells:
a) storage b) energy
c) transport

16. Fiber and chitin are examples of:
a) polysaccharides b) monosaccharides c) disaccharides

17 .What is the name of an organic substance whose molecules contain C, O, H atoms that perform an energy and construction function?A-nucleic acid B-proteinB-carbohydrate G-ATP
18.What carbohydrates are polymers?A-monosaccharides B-disaccharides C-polysaccharides19. The group of monosaccharides includes:A-glucose B-sucrose C-cellulose 20.What is the role of ATP molecules in the cell?A-provide the transport function B-transmit hereditary information C-provide vital processes with energy D-accelerate biochemical reactions
21. Define the terms: DNA, RNA, complementarity, nucleotide, cellulose.22. Problem: A section of a DNA molecule has the following structure:AATGCGATGCTTAGTTTAGG, it is necessary to complete the complementary chain of i-RNA.

Test in biology

"Molecular level"

9th grade

Option 2

1. Lipids differ from other substances:
a) hydrophilic parts
b) hydrophobic parts
c) solubility in water

2. Protein monomers are:
a) amino acids b) monosaccharides c) nucleotides

3. Proteins are:
a) polynucleotides b) polypeptides
c) polysaccharides

4. Arrange the protein structures in sequence:
a) globule b) polymer chain
c) spiral

5. Hydrogen bonds occur in:
a) proteins b) nucleic acids
c) lipids

6. The following is not found in RNA:
a) ribose b) adenine c) glycerol

7. RNA most often consists of:
a) one chain b) two chains
c) individual nucleotides

8. Glycogen performs:
a) transport b) catalytic
c) storage function

9. Protein denaturation occurred when exposed to a small dose of UV. After removing the UV exposure, the protein functions were restored. What levels of structure were affected by denaturation:a) only secondary structure; b) only the primary structure;
c) tertiary and secondary; d) tertiary, secondary and primary.
10. Of the indicated compounds, the following has a lipid nature:a) hemoglobin; b) insulin; c) testosterone; d) penicillin.
11. The DNA strands are held together by:
a) peptide bonds b) ionic bonds
c) hydrogen bonds

12. Monomer of fiber, starch, glycogen is1) fructose 2) amino acid 3) glucose 4) ribose13.How many of the known amino acids are involved in protein synthesis?A-20 B-100 B-23
14. What part of the amino acid molecules distinguishes them from each other?A-radical B-carboxyl group B-amino group
15. What compounds make up ATP?A- adenine, ribose carbohydrate, 3 molecules of phosphoric acidB- guanine, fructose sugar, phosphoric acid residue.B-ribose, glycerol and any amino acid
16. The nucleotide complementary to guanyl nucleotide is:A-thymidyl B-cytidylB-adenylic G-uridylic
17.Which scientist proposed the term “biology”:A) C. Darwin;B) A. Levenguk; B) T. Ruz; D) L. K. Treviranus.
18. Glycogen and cellulose are examples of:
a) polysaccharides b) monosaccharides
c) disaccharides
19.monomers of nucleic acids are:A-amino acids B-fatsB-nucleotides G-glucose
20.What class of chemical substances does ribose belong to?A-protein B-carbohydrate C-lipid
21. Task.In what sequence will the nucleotides be located in the mRNA if the DNA chain has the following composition: GGTATAGCGCTTTAAGCCTT.
22. Define the terms: polysaccharides, enzymes,renaturation, monomer, chitin.

Biology tests 11th grade.

1 option

Enzymes perform the following functions:

A. are the main sources of energy

B. accelerate biochemical reactions

B. transport oxygen

G. participate in chemical reaction, turning into other substances.

The organic substances that make up the cell include:

A. proteins, fats, carbohydrates

B. nucleic acids

D. Anions of weak acids.

Proteins are biological polymers, the monomers of which are:

A. nucleotides

B. amino acids

B. peptides

G. monosaccharides.

A. life and death

B. synthesis and decay

B. excitation and inhibition

5. Choose one “extra” term

A. Molecule

B. reagent

B. reaction

G. enzyme

The products of photosynthesis are presented in the form of monosaccharides and polysaccharides

B. carbohydrates

B. lipids

G. enzymes

7. Affect membrane permeability and the activity of many enzymes

B. carbohydrates

B. lipids

G. hormones

A Replication

9. Synthesis reactions using solar energy are called

A. photolysis

B. Photosynthesis

B. metabolism

G. glycolysis

An elementary particle of genetic information

Biology tests 11th grade.

Topic: “Molecular standard of living”

Option 2

1. The process of releasing the necessary energy from organic substances by breaking them down is called

A. biological oxidation

B. aerobic digestion

B. glycolysis

G. photolysis

Low molecular weight organic substances regulating processes in cells

B. Lipids

B. vitamins

G. enzymes

Substances of a living cell that do not participate in a chemical reaction, but accelerate it:

A. Enzymes

B. Vitamins

B. Hormones

G. Coenzymes

A group of essential small-quantity minerals that ensure the vital functions of organisms

A. Microelements

B. macronutrients

B. Enzymes

G. coenzymes

One of the artificial polymers that turns out to be useful in the human economy:

A. cellulose

B. fluoroplastic

B. polyethylene

G. polystyrene

Substances that destroy pests of agricultural crops and increase their productivity

A. herbicides

B. pesticides

B. Mineral fertilizers

7. Choose one “extra” term

A. Molecule

B. reagent

B. reaction

G. enzyme

8. Choose one “extra” term

B. amino acid

B. macromolecule

G. energy

A biosynthesis

B. photosynthesis

B. broadcast

G. transcription

And carbohydrates

G. carbon

Biology tests 11th grade.

Topic: “Molecular standard of living”

Option 3

1. The products of photosynthesis are presented in the form of monosaccharides and polysaccharides

B. carbohydrates

B. lipids

G. enzymes

2. Substances of a living cell that do not participate in a chemical reaction, but accelerate it:

A. Enzymes

B. Vitamins

B. Hormones

G. Coenzymes

3. The organic substances that make up the cell include:

A. proteins, fats, carbohydrates

B. nucleic acids

D. Anions of weak acids.

4. The process of releasing the necessary energy from organic substances by breaking them down is called

A. biological oxidation

B. aerobic digestion

B. glycolysis

G. photolysis

5. These substances perform construction, protective, and transport functions

B. carbohydrates

B. lipids

G. hormones

6.Bioelements are chemical elements:

A. included in living and inanimate nature

B. cells involved in the life activity

B. constituents of inorganic molecules

G. are the main component of all organic compounds cells.

Metabolism consists of two interconnected and oppositely directed processes:

A. life and death

B. synthesis and decay

B. excitation and inhibition

D. absorption of oxygen and release of carbon dioxide

8. Affect membrane permeability and the activity of many enzymes

B. carbohydrates

B. lipids

G. hormones

9. Choose one “extra” term

B. amino acid

B. macromolecule

G. energy

10. Choose one “extra” term

A biosynthesis

B. photosynthesis

B. broadcast

Municipal educational institution

Sortavala municipal district Republic of Karelia

Average comprehensive school № 3

Diagnostic work in biology "Molecular level"

9th grade

prepared biology teacher of the highest category Lappo Valentina Mikhailovna

Sortavala 2010

Molecular level

1 option

1. All living organisms:

a) have adaptations to environmental conditions

b) develop

c) are heterotrophs

d) capable of metabolism

2. Distinctive function of fats from carbohydrates:

a) construction

b) energy

c) storing

d) protective

3. Monomers of nucleic acids are:

a) amino acids

b) glucose

c) nucleotides

d) nitrogenous bases

4. DNA is different from RNA:

a) location in the cage

b) belonging to biopolymers

c) the remainder H 3 PO 4 , part of the nucleotide

d) the presence of Thymine in the nucleotide

5. Enzyme:

a) biocatalyst

b) participates in the process of synthesis and breakdown of substances

c) most active when t, close to zero

d) has a protein base

6. Viruses are similar to non-living structures in that:

a) capable of reproducing

b) unable to grow

c) have heredity and variability

d) do not produce energy

7. The composition of complex proteins - glycoproteins includes:

a) fats

b) nucleic acids

c) carbohydrates

d) inorganic substances

8. Vitamins:

a) are not used in the cage as a building material

b) are used as a supply of nutrients

c) are biocatalysts

d) do not belong to biocatalysts

B. Determine the correct sequence.

9. Draw the nucleotide sequence of the second strand of DNA, indicating hydrogen bonds:

T-T-G-A-C-C-T-G-A-A.

10. Match the types of nucleic acids and their characteristics.

Nucleic acids Characteristic

A) RNA 1. biopolymer

B) DNA 2. deoxyribose in the monomer

3. N 3 RO 4 as part of a monomer

4. monomers contain ribose

5. consists of monomers

6. contains uracil

7. Nucleotides contain nitrogenous bases

8. A nucleotide consists of three components

9. Contains Thymine

10.located in the cytoplasm and ribosomes

11.located in the nucleus, mitochondria, plastids

12. contains adenine

Diagnostic work in biology

Molecular level

Option 2

A. Select all correct answers. 1. All living organisms: a) capable of metabolism b) have the same structure c) are an open system d) are developing2. Monomer versus polymer: a) has a more complex structure b) has a complex structure c) consists of repeating units d) is a link in a polymer chain3. The same functions of fats and proteins: a) protective b) construction c) storing d) energy4. Protein denaturation is irreversible if the structure is damaged: a) primary b) secondary c) tertiary d) quaternary5. ATP differs from RNA nucleotides: a) the presence of ribose b) absence of uracil c) the presence of three H residues 3 RO 4 d) the presence of adenine6. Viruses are similar to living organisms in that: a) unable to grow b) capable of reproducing c) form a crystalline form of existence d) have heredity and variability7. Nitrogen bases characteristic of DNA: a) guanine b) thymine c) uracil d) cytosine8. Carbohydrates include: a) ribose and lactose b) glycogen and starch c) glycerol and lipids d) cellulose and chitin

B. Make a diagram. 9. Write down the missing DNA nucleotides, indicating hydrogen bonds:A-G-*-C-C-T-*-*-G-CT-*-T-*-*-*-A-Ts-Ts-*

10. Establish a correspondence between the structure of a protein molecule and its characteristics.

Structure of a protein molecule Characteristics

A) primary 1. characteristic of all proteinsB) secondary 2. globuleB) tertiary 3. polypeptide chainD) quaternary 4. helix5. arises as a result of connection several proteins6. formed by a strong peptide bond7. held by numerous hydrogen bondsconnections8. destroyed by reversible denaturation
ANSWERS1 option1

Option 21

Used materials

1. Biology. Introduction to general biology and ecology. Textbook for 9th grade. A.A.Kamensky, E.A.Kriksunov, V.V. Pasechnik M.: Bustard, 2007.

2. Frosin V.N., Sivoglazov V.I. We are preparing for the unified state exam: General biology. - M.: Bustard, 2004. - 216s;

3. Bolgova I.V. Collection of problems on General biology for those entering universities. M.: “Onyx 21st century” “Peace and Education”, 2005;

4. Biology. Educational and training materials for preparing students. "Intellect-Center" 2007